Part:BBa_K5508006
ADH1-neuB-Gal1,10-age-CYC1
The Part consists of BBa_K5508003 and BBa_K5508005. The N-acetylglucosaminidase differential isomerase gene BBa_K5508004(age) is from Anabaena sp. CH1 and the N-acetylneuraminic acid synthesis gene BBa_K5508002(nueB) is from Escherichia coli K1, synthesized by Gene Synthesis. The two genes are at opposite ends of BBa_K5477005 and are under its control.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 374
Illegal AgeI site found at 1905
Illegal AgeI site found at 2291 - 1000COMPATIBLE WITH RFC[1000]
Result
(1)Plasmid Construction
We amplified neuB and age fragments using neuB-Spe-F, neuB-EcoR-R and age-Xho-F , age-Hind-R respectively. The specific sequences of the primers are listed below.
Primer Sequences
| Primer | Sequences (5’-3’) |
|---|---|
| neuB-Spe-F | GGACTAGTTCATTCACCTTGATTCTTGAACTC |
| neuB-EcoR-R | CCGGAATTCATGTCCAACATCTACATTGTTG |
| age-Xho-F | CCGGAATTCATGTCCAACATCTACATTGTTG |
| age-Hind-R | CCCAAGCTTTTAAGACAAAGCCTCAAATTGTTG |
After electrophoretic detection, it was confirmed that both fragments were amplified successfully.
Subsequently, we enzymatically digested the vector and neuB gene fragments with SpeI and EcoR I, respectively, and ligated them using T4 ligase before transferring them into E. coli DH5α competent cells. After screening by transferring into Amp-added LB medium, single colonies were successfully grown after 12h. Colony PCR and sequencing were used to verify whether the gene was successfully inserted into the plasmid.
After confirming the success of the construction, we extracted the plasmid and used it as a vector, which was digested with target genes age using Xho I and Hind III, respectively, and then ligated using T4 ligase. The subsequent steps were the same as before. The correctness of the recombinant plasmid was also determined by colony PCR and sequencing.
（2）SDS-PAGE
The plasmid pESC-neuB-age was transferred into the Saccharomyces cerevisiae BY4741.
To test whether both enzymes are normally expressed, we performed SDS-PAGE. As shown in the figure, the bands between 30 kDa and 50 kDa were darker in colour than the negative control bands, but there was no significant increase in the bands, probably due to the lower expression.
（3）N-acetylneuraminic acid production by colorimetric assay
For the detection of N-acetylneuraminic acid in the fermentation broth, a commercial kit was chosen. This kit is based on the principle that N-acetylneuraminic acid forms a purplish-red complex with 5-Methylresorcinol in the presence of an oxidising agent, and the absorbance follows the colourimetric law. The amount of N-acetylneuraminic acid can be calculated by measuring the absorbance of the complex and comparing it to a standard.
In order to avoid errors caused by other components in the medium, we transfected the pESC-URA plasmid into BY4741 as a negative control, which was cultured and induced in exactly the same way as the engineered bacterium pESC-neuB-age /BY4741.
Compared to the negative control tubes, we found that the colour of the engineered bacterium pESC-neuB-age/BY4741 appeared significantly deeper and the absorbance increased. From the measurement of absorbance and calculation, we can see that after 48h fermentation, the yield of N-acetylneuraminic acid was about 0.7 g/L.
| None |